ERG Responses in Albinism, Idiopathic Infantile Nystagmus, and Controls.

Purpose: Our primary aim was to compare adult full-field ERG (ffERG) responses in albinism, idiopathic infantile nystagmus (IIN), and controls. A secondary aim was to investigate the effect of within-subject changes in nystagmus eye movements on ffERG responses. Methods: Dilated Ganzfeld flash ffERG responses were recorded using DTL electrodes under conditions of dark (standard and dim flash) and light adaptation in 68 participants with albinism, 43 with IIN, and 24 controls. For the primary aim, the effect of group and age on ffERG responses was investigated. For the secondary aim, null region characteristics were determined using eye movements recorded prior to ffERG recordings. ffERG responses were recorded near and away from the null regions of 18 participants also measuring the success rate of recordings. Results: For the primary aim, age-adjusted photopic a- and b-wave amplitudes were consistently smaller in IIN compared with controls (P < 0.0001), with responses in both groups decreasing with age. In contrast, photopic a-wave amplitudes increased with age in albinism (P = 0.0035). For the secondary aim, more intense nystagmus significantly reduced the success rate of measurable responses. Within-subject changes in nystagmus intensity generated small, borderline significant differences in photopic b-wave peak times and a-and b-wave amplitudes under scotopic conditions with standard flash. Conclusions: Age-adjusted photopic ffERG responses are significantly reduced in IIN adding to the growing body of evidence of retinal abnormalities in IIN. Differences between photopic responses in albinism and controls depend on age. Success at obtaining ffERG responses could be improved by recording responses at the null region.

Visual Field Deficits in Albinism in Comparison to Idiopathic Infantile Nystagmus.

Purpose: This is the first systematic comparison of visual field (VF) deficits in people with albinism (PwA) and idiopathic infantile nystagmus (PwIIN) using static perimetry. We also compare best-corrected visual acuity (BCVA) and optical coherence tomography measures of the fovea, parafovea, and circumpapillary retinal nerve fiber layer in PwA. Methods: VF testing was performed on 62 PwA and 36 PwIIN using a Humphrey Field Analyzer (SITA FAST 24-2). Mean detection thresholds for each eye were calculated, along with quadrants and central measures. Retinal layers were manually segmented in the macular region. Results: Mean detection thresholds were significantly lower than normative values for PwA (-3.10 ± 1.67 dB, P << 0.0001) and PwIIN (-1.70 ± 1.54 dB, P < 0.0001). Mean detection thresholds were significantly lower in PwA compared to PwIIN (P < 0.0001) and significantly worse for left compared to right eyes in PwA (P = 0.0002) but not in PwIIN (P = 0.37). In PwA, the superior nasal VF was significantly worse than other quadrants (P < 0.05). PwIIN appeared to show a mild relative arcuate scotoma. In PwA, central detection thresholds were correlated with foveal changes in the inner and outer retina. VF was strongly correlated to BCVA in both groups. Conclusions: Clear peripheral and central VF deficits exist in PwA and PwIIN, and static VF results need to be interpreted with caution clinically. Since PwA exhibit considerably lower detection thresholds compared to PwIIN, VF defects are unlikely to be due to nystagmus in PwA. In addition to horizontal VF asymmetry, PwA exhibit both vertical and interocular asymmetries, which needs further exploration.

Truncated FRMD7 proteins in congenital Nystagmus: novel frameshift mutations and proteasomal pathway implications.

Idiopathic congenital nystagmus (ICN) manifests as involuntary and periodic eye movements. To identify the genetic defect associated with X-linked ICN, Whole Exome Sequencing (WES) was conducted in two affected families. We identified two frameshift mutations in FRMD7, c.1492dupT/p.(Y498Lfs*15) and c.1616delG/p.(R539Kfs*2). Plasmids harboring the mutated genes and qPCR analysis revealed mRNA stability, evading degradation via the NMD pathway, and corroborated truncated protein production via Western-blot analysis. Notably, both truncated proteins were degraded through the proteasomal (ubiquitination) pathway, suggesting potential therapeutic avenues targeting this pathway for similar mutations. Moreover, we conducted a comprehensive analysis, summarizing 140 mutations within the FRMD7 gene. Our findings highlight the FERM and FA structural domains as mutation-prone regions. Interestingly, exons 9 and 12 are the most mutated regions, but 90% (28/31) mutations in exon 9 are missense while 84% (21/25) mutations in exon 12 are frameshift. A predominant occurrence of shift code mutations was observed in exons 11 and 12, possibly associated with the localization of premature termination codons (PTCs), leading to the generation of deleterious truncated proteins. Additionally, our conjecture suggests that the loss of FRMD7 protein function might not solely drive pathology; rather, the emergence of aberrant protein function could be pivotal in nystagmus etiology. We propose a dependence of FRMD7 protein normal function primarily on its anterior domain. Future investigations are warranted to validate this hypothesis.

A common cause for nystagmus in different congenital stationary night blindness mouse models.

In Nyxnob mice, a model for congenital nystagmus associated with congenital stationary night blindness (CSNB), synchronous oscillating retinal ganglion cells (RGCs) lead to oscillatory eye movements, i.e. nystagmus. Given the specific expression of mGluR6 and Cav 1.4 in the photoreceptor to bipolar cell synapses, as well as their clinical association with CSNB, we hypothesize that Grm6nob3 and Cav 1.4-KO mutants show, like the Nyxnob mouse, oscillations in both their RGC activity and eye movements. Using multi-electrode array recordings of RGCs and measurements of the eye movements, we demonstrate that Grm6nob3 and Cav 1.4-KO mice also show oscillations of their RGCs as well as a nystagmus. Interestingly, the preferred frequencies of RGC activity as well as the eye movement oscillations of the Grm6nob3 , Cav 1.4-KO and Nyxnob mice differ among mutants, but the neuronal activity and eye movement behaviour within a strain remain aligned in the same frequency domain. Model simulations indicate that mutations affecting the photoreceptor-bipolar cell synapse can form a common cause of the nystagmus of CSNB by driving oscillations in RGCs via AII amacrine cells. KEY POINTS: In Nyxnob mice, a model for congenital nystagmus associated with congenital stationary night blindness (CSNB), their oscillatory eye movements (i.e. nystagmus) are caused by synchronous oscillating retinal ganglion cells. Here we show that the same mechanism applies for two other CSNB mouse models - Grm6nob3 and Cav 1.4-KO mice. We propose that the retinal ganglion cell oscillations originate in the AII amacrine cells. Model simulations show that by only changing the input to ON-bipolar cells, all phenotypical differences between the various genetic mouse models can be reproduced.

Long-Term Visual and Neurodevelopmental Outcomes in Two Children with Congenital Nystagmus Secondary to Methadone Exposure In utero.

Methadone is used as a substitute for illicit opioids during pregnancy. However, the real effect of this molecule on visual and neurodevelopmental outcomes of the children exposed is not fully understood, since studies considered subjects born to polydrug-dependent mothers and followed for few months/years. We report the long-term outcomes of two infants with congenital nystagmus solely exposed to methadone in utero. Neurological and neurovisual evaluations were performed every year from the first year of life to 11 years of age. One child was diagnosed with developmental coordination disorder. Both cases presented with ophthalmologic (refractive errors), oculomotor (nystagmus and fixation, smooth pursuit, and saccades dysfunctions), and perceptive problems (reduced visual acuity and contrast sensitivity). While nystagmus and other oculomotor dysfunctions remained stable over time, visual acuity and contrast sensitivity improved; refractive errors worsened and required corrective lenses. Both children showed normal neurodevelopmental and cognitive profile. This report highlights the long-term visual and developmental outcomes of two children exclusively exposed to methadone underlining the possibility of a visual dysfunction and motor coordination disorder. These observations prompt the need to investigate prenatal drug exposure as a cause of congenital nystagmus.

Best-corrected visual acuity results facilitate molecular diagnosis of infantile nystagmus patients harboring FRMD7 mutations.

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.

Micro chromosomal deletions at the NYS7 locus and autosomal dominant nystagmus.

Nystagmus is an ocular condition characterized by bilateral involuntary ocular oscillation which can severely affect vision. When not associated with other ocular or systemic diseases, it is referred to as idiopathic or congenital motor nystagmus (CMN). Genome-wide linkage studies have previously identified several loci associated with CMN, however the genes responsible for some of these loci have yet to be identified. We have examined a large, five-generation family with autosomal dominant CMN. Our purpose was to characterize the clinical manifestations and reveal the molecular basis of the disease in this family. In addition to full ophthalmic examination and imaging, molecular analysis included copy number variation analysis, linkage studies, and Sanger sequencing. Expression analyses of candidate genes was done by real-time PCR. Of the 68 family members, 27 subjects in five-generations had CMN, in line with an autosomal dominant inheritance pattern. Molecular analysis was performed on 27 members, 15 of them affected by CMN. Copy number variation analysis using array comparative genomic hybridization (aCGH) revealed a novel deletion located on 1q32 (NYS7) among affected individuals. Linkage analysis using polymorphic markers demonstrated full segregation with a heterozygous haplotype in all affected patients, with a LOD score of >5. Sanger sequencing of affected subjects revealed a novel deletion of 732,526 bp in the linkage interval. No protein-coding genes exist within the deleted region; however, the deletion disrupts topologically associated domains encompassing the gene NR5A2 and the non-protein coding MIR181A. Both are strongly associated with other genes expressed in the retina such as PROX1, which in turn is also associated with genes related to nystagmus such as PAX6. We therefore hypothesized that the deletion might affect NR5A2 and MIR181A expression, causing CMN. Expression analysis by real-time PCR showed significantly lower expression of NR5A2, and significantly higher expression of PROX1 among patients compared with controls. To conclude, among a large five-generation family with autosomal dominant CMN, a large deletion in the interval of NYS7 was linked with the disease. No protein-coding genes exist inside the deleted region, and so the exact mechanism in which CMN is caused is uncertain. Based on topological association and expression analyses we suggest a possible mechanism for the pathogenesis.

Disrupted voxel-mirrored homotopic connectivity in congenital nystagmus using resting-state fMRI.

OBJECTIVES: Idiopathic congenital nystagmus (CN) is a rare eye disease that can cause early blindness (EB). CN deficits are observed most frequently with oculomotor dysfunction; however, it is still unclear what neuromechanics underly CN with EB. Based on that visual experience requires the functional integration of both hemispheres, we hypothesized that CN adolescents with EB might exhibit impaired interhemispheric synchrony. Our study aimed to investigate the interhemispheric functional connectivity alterations using voxel-mirrored homotopic connectivity (VMHC) and their relationships with clinical features in CN patients. MATERIALS AND METHODS: This study included 21 patients with CN and EB, and 21 sighted controls (SC), who were matched for sex, age and educational level. The 3.0 T MRI scan and ocular examination were performed. The VMHC differences were examined between the two groups, and the relationships between mean VMHC values in altered brain regions and clinical variables in the CN group were evaluated by Pearson correlation analysis. RESULTS: Compared with the SC group, the CN had increased VMHC values in the bilateral cerebellum posterior and anterior lobes/cerebellar tonsil/declive/pyramis/culmen/pons, middle frontal gyri (BA 10) and frontal eye field/superior frontal gyri (BA 6 and BA 8). No particular areas of the brain had lower VMHC values. Furthermore, no correlation with the duration of disease or blindness could be demonstrated in CN. CONCLUSION: Our results suggest the existence of interhemispheric connectivity changes and provide further evidence for the neurological basis of CN with EB.

[Nystagmus in Children - a Survey]. / Nystagmus bei Kindern ­ eine Übersicht.

Nystagmus describes an involuntary, periodic movement of one or both eyes. About 1/600 children and adolescents have nystagmus, most of them idiopathic infantile nystagmus (IIN), also called "congenital nystagmus", which can be caused by mutations in the FRMD7 gene. Other frequent forms of nystagmus are latent nystagmus, which is usually associated with infantile strabismus, and nystagmus associated with albinism. Sometimes difficult to distinguish in young infants is a sensory nystagmus, where a defect in the visual system reduces vision and causes nystagmus. Causes include retinal dystrophies, congenital stationary night blindness and structural ocular defects including optic nerve hypoplasia or dense bilateral congenital cataracts. Unilateral nystagmus can be the sign of an anterior visual pathway lesion. Seesaw nystagmus may be associated with suprasellar and mesodiencephalic lesions and - rarely - with retinal dystrophies.The ophthalmology plays a key role in identifying the form of nystagmus. Children with new onset nystagmus, with spasmus nutans, with vertical or unilateral nystagmus and those with seesaw nystagmus require neurologic evaluation including imaging of the brain.The treatment of nystagmus depends on the underlying cause. Even minor refractive errors should be corrected, contact lenses offer advantages over glasses.Gabapentin and memantine, possibly also carbonic anhydrase inhibitors, are effective in treating IIN, nystagmus in albinism and sensory nystagmus. Nevertheless, pharmacologic treatment of nystagmus is rarely used in children; the reasons are the limited effects on vision, the need for lifelong therapy, and potential side effects. Eye muscle surgery (Anderson procedure, Kestenbaum procedure) can correct a nystagmus-related anomalous head posture. The concept of "artifical divergence" of Cüppers may help to decrease nystagmus intensity in patients whose nystagmus dampens with convergence. The four-muscle-tenotomy, which involves disinsertion and reinsertion of the horizontal muscles at the original insertion of both eyes, has a proven but limited positive effect on visual acuity.

FRMD7 Gene Alterations in a Pakistani Family Associated with Congenital Idiopathic Nystagmus.

Congenital idiopathic nystagmus (CIN) is an oculomotor disorder characterized by repetitive and rapid involuntary movement of the eye that usually develops in the first six months after birth. Unlike other forms of nystagmus, CIN is widely associated with mutations in the FRMD7 gene. This study involves the molecular genetic analysis of a consanguineous Pakistani family with individuals suffering from CIN to undermine any potential pathogenic mutations. Blood samples were taken from affected and normal individuals of the family. Genomic DNA was extracted using an in-organic method. Whole Exome Sequencing (WES) and analysis were performed to find any mutations in the causative gene. To validate the existence and co-segregation of the FRMD7 gene variant found using WES, sanger sequencing was also carried out using primers that targeted all of the FRMD7 coding exons. Additionally, the pathogenicity of the identified variant was assessed using different bioinformatic tools. The WES results identified a novel nonsense mutation in the FRMD7 (c.443T>A; p. Leu148 *) gene in affected individuals from the Pakistani family, with CIN resulting in a premature termination codon, further resulting in the formation of a destabilized protein structure that was incomplete. Co-segregation analysis revealed that affected males are hemizygous for the mutated allele c.443T>A; p. Leu148 * and the affected mother is heterozygous. Overall, such molecular genetic studies expand our current knowledge of the mutations associated with the FRMD7 gene in Pakistani families with CIN and significantly enhance our understanding of the molecular mechanisms involved in genetic disorders.

Expanding the mutational spectrum of FHONDA syndrome.

AIM: The aim of the study is to present a rare case of Foveal Hypoplasia, Optic Nerve Decussation defects, and Anterior segment dysgenesis (FHONDA) confirmed by genetic testing with two separate pathogenic mutations in the SLC38A8 gene. MATERIALS AND METHODS: This was a case report. RESULTS: A 3-month-old female presented to a neuro-ophthalmology clinic with nystagmus. Her past medical and family history was unremarkable. Her examination demonstrated horizontal pendular nystagmus and small optic nerves with foveal hypoplasia bilaterally. Neuroimaging was unremarkable. She underwent an examination under anesthesia and electroretinogram (ERG). Her anterior segment examination was normal, and dilated fundus examination demonstrated foveal hypoplasia with diffuse pigment granularity. The ERG was normal. Genetic testing revealed two mutations in the SLC38A8 gene, p.Glu233Lys:c.697 G>A (pathogenic) and p.Asp283Ala:c.848A>C (likely pathogenic) with positive parental segregation analysis. Therefore, she was diagnosed with FHONDA. CONCLUSIONS: To our knowledge, this is the first report of a patient with FHONDA who is compound heterozygous for these two SLC38A8 mutations, which represents an expansion of the known mutational spectrum associated with this syndrome. Moreover, it may provide guidance into genetic counseling for patients and parents with these mutations.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Expanding the Spectrum of Oculocutaneous Albinism: Does Isolated Foveal Hypoplasia Really Exist?

Oculocutaneous albinism is an autosomal recessive disorder characterized by the presence of typical ocular features, such as foveal hypoplasia, iris translucency, hypopigmented fundus oculi and reduced pigmentation of skin and hair. Albino patients can show significant clinical variability; some individuals can present with only mild depigmentation and subtle ocular changes. Here, we provide a retrospective review of the standardized clinical charts of patients firstly addressed for evaluation of foveal hypoplasia and slightly subnormal visual acuity, whose diagnosis of albinism was achieved only after extensive phenotypic and genotypic characterization. Our report corroborates the pathogenicity of the two common TYR polymorphisms p.(Arg402Gln) and p.(Ser192Tyr) when both are located in trans with a pathogenic TYR variant and aims to expand the phenotypic spectrum of albinism in order to increase the detection rate of the albino phenotype. Our data also suggest that isolated foveal hypoplasia should be considered a clinical sign instead of a definitive diagnosis of an isolated clinical entity, and we recommend deep phenotypic and molecular characterization in such patients to achieve a proper diagnosis.

Noncanonical Splice Site and Deep Intronic FRMD7 Variants Activate Cryptic Exons in X-linked Infantile Nystagmus.

Purpose: We aim to report noncoding pathogenic variants in patients with FRMD7-related infantile nystagmus (FIN). Methods: Genome sequencing (n = 2 families) and reanalysis of targeted panel next generation sequencing (n = 2 families) was performed in genetically unsolved cases of suspected FIN. Previous sequence analysis showed no pathogenic coding variants in genes associated with infantile nystagmus. SpliceAI, SpliceRover, and Alamut consensus programs were used to annotate noncoding variants. Minigene splicing assay was performed to confirm aberrant splicing. In silico analysis of exonic splicing enhancer and silencer was also performed. Results: FRMD7 intronic variants were identified based on genome sequencing and targeted next-generation sequencing analysis. These included c.285-12A>G (pedigree 1), c.284+63T>A (pedigrees 2 and 3), and c. 383-1368A>G (pedigree 4). All variants were absent in gnomAD, and the both c.285-12A>G and c.284+63T>A variants were predicted to enhance new splicing acceptor gains with SpliceAI, SpliceRover, and Alamut consensus approaches. However, the c.383-1368 A>G variant only had a significant impact score on the SpliceRover program. The c.383-1368A>G variant was predicted to promote pseudoexon inclusion by binding of exonic splicing enhancer. Aberrant exonizations were validated through minigene constructs, and all variants were segregated in the families. Conclusions: Deep learning-based annotation of noncoding variants facilitates the discovery of hidden genetic variations in patients with FIN. This study provides evidence of effectiveness of combined deep learning-based splicing tools to identify hidden pathogenic variants in previously unsolved patients with infantile nystagmus. Translational Relevance: These results demonstrate robust analysis using two deep learning splicing predictions and in vitro functional study can lead to finding hidden genetic variations in unsolved patients.

Correlations of FRMD7 gene mutations with ocular oscillations.

Mutations in the FERM domain containing 7 (FRMD7) gene have been proven to be responsible for infantile nystagmus (IN). The purpose of this study is to investigate FRMD7 gene mutations in patients with IN, and to evaluate the nystagmus intensity among patients with and without FRMD7 mutations. The affected males were subdivided into three groups according to whether or not having FRMD7 mutations and the types of mutations. Fifty-two mutations were detected in FRMD7 in 56 pedigrees and 34 sporadic patients with IN, including 28 novel and 24 previous reported mutations. The novel identified mutations further expand the spectrum of FRMD7 mutations. The parameters of nystagmus intensity and the patients' best corrected visual acuity were not statistically different among the patients with and without identified FRMD7 mutations, and also not different among patients with different mutant types. The FERM-C domain, whose amino acids are encoded by exons 7, 8 and 9, could be the harbor region for most mutations. Loss-of-function is suggested to be the common molecular mechanism for the X-linked infantile nystagmus.

Infantile nystagmus without overt eye abnormality: Early features and neuro-ophthalmological diagnosis.

AIM: To analyse the neuro-ophthalmological data of children referred for further work-up of infantile nystagmus where ophthalmological evaluation had not achieved a diagnosis. METHOD: We retrospectively reviewed medical records of patients presenting with infantile nystagmus at our institution between 2007 and 2019. Inclusion criteria were onset before 6 months of age, availability of complete ophthalmic examination, visual electrophysiological tests, and neurological examination. Children with a previous definite ophthalmological diagnosis at onset and those with uncertain nystagmus onset age were not recruited. RESULTS: Out of 142 infants (mean age at nystagmus onset 3.6 mo, SD 1.7, range 0-6 mo; 56 females, 86 males), 23% had neurological nystagmus, 7% mixed neurological and sensory nystagmus, 48% sensory defect, and 22% idiopathic infantile nystagmus. The neurological diagnoses were inborn errors of metabolism, white matter genetic disorders, and brain malformations. The prevalent diagnosis in the sensory defect subgroup was retinal dystrophy. INTERPRETATION: Infantile nystagmus without diagnostic ocular findings may be due to neurological, retinal, and optic nerve disorders or be a benign idiopathic condition. In infants with and without neurological abnormalities, the search for a sensory defect should include visual electrophysiology performed early in the diagnostic pathway. WHAT THIS PAPER ADDS: Infantile nystagmus without diagnostic ophthalmological signs has an underlying neurological cause in 30% of cases. Neurological diagnoses include congenital brain malformations, and metabolic and genetic disorders. Sensory defects are part of systemic neurological disorders in 23% of infants. Electrophysiology is useful when ophthalmological examination is uninformative.

Modulating brain function with microbiota.

Microbial metabolites identified in animal models and human neurological diseases could be therapeutic targets.

Abnormal Retinal Vessel Architecture in Albinism and Idiopathic Infantile Nystagmus.

Purpose: Infantile nystagmus syndrome (INS) causes altered visual development and can be associated with abnormal retinal structure, to which vascular development of the retina is closely related. Abnormal retinal vasculature has previously been noted in albinism but not idiopathic infantile nystagmus. We compared the number and diameter of retinal vessels in participants with albinism (PWA) and idiopathic infantile nystagmus (PWIIN) with controls. Methods: Fundus photography data from 24 PWA, 10 PWIIN, and 34 controls was analyzed using Automated Retinal Image Analyzer (ARIA) software on a field of analysis centered on the optic disc, the annulus of which extended between 4.2 mm and 8.4 mm in diameter. Results: Compared with controls, the mean number of arterial branches was reduced by 24% in PWA (15.5 vs. 20.3, P < 0.001), and venous branches were reduced in both PWA (29%; 12.9 vs. 18.2, P < 0.001) and PWIIN (17%; 15.1 vs. 18.2, P = 0.024). PWA demonstrated 7% thinner "primary" (before branching) arteries (mean diameter: 75.39 µm vs. 80.88 µm, P = 0.043), and 13% thicker (after branching) "secondary" veins (66.72 µm vs. 59.01 µm in controls, P = 0.009). Conclusions: PWA and PWIIN demonstrated reduced retinal vessel counts and arterial diameters compared with controls. These changes in the superficial retinal vascular network may be secondary to underdevelopment of the neuronal network, which guides vascular development and is also known to be disrupted in INS.